Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?
High-Yield Explanation
Looking at the coding segment of the normal b-gene of hemoglobin, one should read the information codon by codon, as follows: AAG UAU CAC UAA GCU CGC 1 2 3 4 5 6 The normal b-globin gene has a stop codon (UAA) at the 4th position, therefore the last 2 codons (GCU and CGC) are not translated and do not code for amino acid residues found in the protein. Comparing this information to the coding segment of the mutated b-gene of hemoglobin Cranston, one would notice the following: AAG AGU AUC ACU AAG CUC GCU UUC UAU UAA 1 2 3 4 5 6 7 8 etc etc The inseion of two base pairs (AG) results in a frameshift mutation that eliminates the stop codon at position 4, thereby causing the addition of amino acids normally not translated in the hemoglobin b-chain of the child. Since the chain is now too long, this destabilizes the tetrameric conformation of hemoglobin. A frameshift mutation resulting in deletion of several amino acids is wrong, since such a mutation would have inseed a stop codon (UAA, UGA or UAG) before position 4. A mutation in the stop codon would have resulted in a longer-than-normal b-globin gene, but the information given does not indicate any changes in the stop codon at position 4. Interestingly, a chain elongation by mutation in the stop codon exists and is known as hemoglobin Constant Spring, affecting the a-chain of hemoglobin. A point mutation is the result of a single base pair change, which is not the case here. A point mutation resulting in the inseion of a new stop codon is called a nonsense mutation, and it would result in a shoer-than-normal protein. Ref: Weil P. (2011). Chapter 37. Protein Synthesis & the Genetic Code. In D.A. Bender, K.M. Botham, P.A. Weil, P.J. Kennelly, R.K. Murray, V.W. Rodwell (Eds), Harper's Illustrated Biochemistry, 29e.