If one strand of DNA contains the sequence "ATCGCGTAACATGGATTCGG", what will be the sequence of the complementary strand using the standard convention?
High-Yield Explanation
If one strand of DNA contains the sequence " 5' ATCGCGTAACATGGATTCGG 3' " the sequence of the complementary strand will be 5' CCGAATCCATGTTACGCGAT 3' DNA and RNA are directional molecules. They are always written in the sequence of 5' to 3'. Phosphodiester bonds link the 3'- and 5'-carbons of adjacent monomers. Each end of a nucleotide polymer thus is distinct. We therefore refer to the "5'-end" or the "3'-end" of a polynucleotide, the 5'-end being that with a free or phosphorylated 5'-hydroxyl group. DNA sequences are complementary and antiparallel to each other. So, the complementary sequence of ATCGCGTAACATGGATTCGG will be CCGAATCCATGTTACGCGAT. Note: In question or answer option if nothing is mentioned about the direction of the sequence, you have to automatically assume that they are asking in 5'-3' direction as it is internationally accepted convention.